Skip to main content
  • Research article
  • Open access
  • Published:

The function of tcf3 in medaka embryos: efficient knockdown with pePNAs

Abstract

Background

The application of antisense molecules, such as morpholino oligonucleotides, is an efficient method of gene inactivation in vivo. We recently introduced phosphonic ester modified peptide nucleic acids (PNA) for in vivo loss-of-function experiments in medaka embryos. Here we tested novel modifications of the PNA backbone to knockdown the medaka tcf3 gene.

Results

A single tcf3 gene exists in the medaka genome and its inactivation strongly affected eye development of the embryos, leading to size reduction and anophthalmia in severe cases. The function of Tcf3 strongly depends on co-repressor interactions. We found interactions with Groucho/Tle proteins to be most important for eye development. Using a dominant negative approach for combined inactivation of all groucho/tle genes also resulted in eye phenotypes, as did interference with three individual tle genes.

Conclusions

Our results show that side chain modified PNAs come close to the knockdown efficiency of morpholino oligonucleotides in vivo. A single medaka tcf3 gene combines the function of the two zebrafish paralogs hdl and tcf3b. In combination with Groucho/Tle corepressor proteins Tcf3 acts in anterior development and is critical for eye formation.

Background

Antisense molecules which inhibit mRNA activity through a Watson-Crick base pair mechanism have been studied for several decades. Blocker molecules, such as morpholino oligonucleotides and peptide nucleic acids (PNAs), show high specificity and low toxic effects (reviewed by Summerton [1]). The morpholino backbone consists of 6-membered morpholine rings connected by non-ionic phosphorodiamidate linker-units [2]. In PNAs the phosphate ribose ring of DNA is replaced with repeating N-[2-aminoethyl]-glycine (aeg) units linked by amide bonds. This provides a neutral backbone and results in complementary PNA/DNA strands having stronger binding affinity than DNA/DNA [3]. In addition, introduction of mismatches destabilizes the PNA/DNA duplex more than they do in DNA/DNA. PNAs are highly stable against enzymatic degradation and changes in temperature and pH. Moreover, due to their short length (13-18 bases) the likelihood that secondary structures form is reduced which results in stable and sequence specific probes [4,5,6]. Unmodified aegPNAs, however, show low efficiency in vivo, therefore, various terminal- and internal modifications have been tested. For example, the addition of lysine residues improves their solubility [7]. The introduction of negative charges in mixed sequence HypNA-PNAs allowed specific down regulation of target genes in zebrafish embryos [8]. Recently, pePNAs which contain phosphonic ester (pe) side chains in an otherwise non-modified aegPNA backbone were successfully applied to target six3 in medaka embryos. In particular combined versions containing both aeg non-modified- and pe-modified PNA blocks were most effective. In a direct comparison morpholino oligonucleotides were active at lower concentrations, but also showed higher toxicity [9].

Tcf/Lef (T-cell factor/lymphoid enhancer factor) proteins belong to the high mobility group (HMG) box-containing family of transcription factors [10]. They are the most distal players of the canonical Wnt pathway and the main partner for β-catenin in gene regulation [11, 12]. In the absence of Wnt ligands, β-catenin is degraded in the cytosol and Tcf/Lef interacts with transcriptional co-repressors such as Groucho/Tle (Groucho/Transducin-like enhancer) and CtBP (C-terminus Binding Protein), thereby repressing target gene expression [13]. Upon Wnt stimulation, β-catenin is stabilized and translocated into the nucleus. Nuclear accumulation leads to interaction of β-catenin with Tcf/Lef which promotes specific gene expression [11].

In non-vertebrates transcriptional activation and repression is regulated solely by a single tcf gene, for example pangolin in Drosophila and POP-1 in C. elegans, whereas vertebrates have four, more specialized and partly redundant homologues (tcf1, tcf3, tcf4 and lef1) [11]. While Tcf1 and Tcf4 proteins play a role in both activation and repression, Lef1 primarily functions as an activator [14] and Tcf3 appears to function exclusively as a repressor [15]. In mice, tcf3 knockout experiments resulted in gastrulation defects that resemble ectopic Wnt expression such as duplication of the anterior-posterior (AP) axis. At later stages abundant neuroectodermal cells and defective neural patterning were observed [16]. In addition, Tcf3 seems to be a regulator of pluripotency. Embryonic stem (ES) cells show high levels of Tcf3 and only low Wnt pathway activity, thereby remaining in a balanced state between pluripotency and differentiation. When tcf3 is knocked down or Wnt genes are overexpressed, the ES cells do not undergo efficient differentiation and the balance is tipped towards pluripotency [17, 18]. In zebrafish two tcf3 genes have been reported, headless hdl/tcf3 [19] and tcf3b [20], which both act as repressors. At the shield stage (mid-gastrulation) hdl is broadly expressed in the epiblast while tcf3b demonstrates only weak expression, at late gastrulation both genes are expressed in the rostral neuroectoderm and later on throughout the brain with a gap of expression in the mid-hindbrain boundary (MHB) [20]. In hdl mutants the forebrain is lost while the expression of genes that characterize the MHB is expanded [19]. This phenotype can be rescued by tcf3b overexpression, indicating redundant functions of hdl and tcf3b [20]. tcf3b knockdown results in smaller heads but otherwise normal brain patterning, whereas interference with both tcf3 genes leads to strong caudalization [20].

One mechanism of Tcf3-mediated repression results from its interaction with Groucho/Tle proteins [13, 21, 22], which are transcriptional co-repressors that lack direct DNA-binding ability. Instead they bind to DNA-bound proteins and assist in repression (reviewed by Turki-Judeh and Courey [23]). In the case of Tcf3, Groucho/Tle tetramers bind to an N-terminally located groucho interaction domain [24]. This interaction is disrupted by the Groucho/Tle repressor Aes [21], which is a truncated form of Groucho/Tle consisting only of the N-terminal Q- and GP-domains [25, 26].

Here we analyzed the function of tcf3 in medaka embryos using both gain- and loss-of-function experiments. For the knockdown we used pePNAs and morpholino oligonucleotides. Novel side chain modifications further improved the activity of the PNAs, resulting in knockdown efficiencies directly comparable to those of the morpholino oligonucleotides. Furthermore, we analyzed the effect of Groucho/Tle proteins on the repressive function of Tcf3 using a dominant negative approach and antisense oligonucleotides.

Results

Isolation and expression of the medaka tcf3 gene

We used a BLAST search to identify homologs of the tcf3 gene in the medaka genome, using the mouse Tcf3 protein sequence as a template. In this work, we identified several homologs of tcf/lef genes, however, only one single hit matched the tcf3 gene (corresponding Ensembl transcript ENSORLT00000014810 located on chromosome 9 and encoding for a 600 amino acid protein). The presence of a single tcf3 gene in medaka was also reported previously [27]. In order to study the expression pattern of the medaka tcf3 gene, we isolated a cDNA fragment by RT-PCR and performed whole mount in situ hybridization (Fig. 1). During gastrulation, tcf3 is broadly expressed throughout the embryonic shield (40% epiboly; Fig. 1a), followed by an anterior shift towards the prospective head region (Fig. 1c) and into the embryonic body (Fig. 1b,c) at late gastrula stage. At the neurula stage the expression becomes restricted to the head region (Fig. 1d,d’) and appears in posterior regions of the embryo later during somitogenesis (Fig. 1e-h’). When the first subdivisions of the brain can be distinguished, tcf3 expression becomes segmented into the telencephalon, midbrain and hindbrain domains (Fig. 1e,e’). Similar to the expression of zebrafish tcf3 [20], medaka tcf3 is not expressed in the MHB (Fig. 1e-g). Furthermore, tcf3 is also expressed in the eyes and the otic placodes (Fig. 1e). During somitogenesis, tcf3 expression further extends caudally (Fig. 1f-h’), where it is then found in the pectoral fins and the somites in late stages (Fig. 1h, h’). Interestingly, the expression pattern of tcf3 in medaka combines the expression domains of the zebrafish genes hdl (tcf3a) and tcf3b [20].

Fig. 1
figure 1

tcf3 expression in medaka embryonic development. Whole mount in situ hybridization experiments were performed in wild type embryos at the indicated stages, using a digoxigenin-labelled RNA probe against tcf3. Embryos are shown in dorsal view, anterior at the top. (f-h) Flat mounts; (f'-h') tail view. During gastrulation (a-c) tcf3 is expressed throughout the epiblast and the embryonic body (c-d). In neurula the expression becomes restricted to the head (d,d') from where it spreads caudally and divides into a forebrain, midbrain, and hindbrain section (e;e'). A gap in expression at the mid-hindbrain boundary (f-h, arrowhead) is closed at later stages (h). In later stages, expression is observed throughout the entire body (g-h'). Scale bars 100 μm; a, a-c; f, f-f′; g, g-h′. Abbreviations: st, stage

The medaka tcf3 gene is crucial for eye development

In order to understand the function of the medaka tcf3 gene during embryogenesis, we performed knockdown experiments using PNAs and morpholino oligonucleotides. We used a 16mer mixed pePNA (Fig. 2a) and a 25mer morpholino oligonucleotide sequence directed against the medaka tcf3 mRNA directly upstream of the translation start codon (Fig. 2b). Injection of PNAs and morpholino oligonucleotides resulted in the same phenotypes. The embryos progressed through gastrulation without apparent defects; however, eye development was later specifically impaired (Fig. 3b-d). For phenotype classification, we separated the embryos into three groups (weak, moderate and strong): weak embryos (Fig. 3b,f) exhibited one or two slightly smaller eyes than the control group, whereas in embryos with a moderate phenotype the size reduction was severe (Fig. 3c,g). Embryos without eyes were categorized as having a strong phenotype (Fig. 3d,h). Interestingly, in zebrafish the phenotypes for the two tcf3 genes differ considerably, however, in hdl/tcf3b double morphants they add up to one combined phenotype representing the complete absence of Tcf3 proteins [20]. Medaka embryos with a strong phenotype correspond to this extreme case, whereas embryos of the weak and moderate groups demonstrate phenotypes in between those for hdl [19] and tcf3b [20] in zebrafish.

Fig. 2
figure 2

Sequences of medaka tcf3 antisense molecules and their targets. a Schematic chemical structure of aegPNAs, pePNAs. Mixed PNAs contain C3- (R1) or lysine-phosphonic-ester- (R2) residues. b mRNA targets are shown in the 5′-3′ orientation, capital letters indicate the coding region. The AUG start codon is underlined. Pre-mRNA represents the unspliced mRNA precursor of the medaka tcf3 gene with exon 1 sequences shown in capital letters (exon 1 includes the first 62 amino acids of Tcf3). Tcf3MO represents a morpholino oligonucleotide, all other sequences PNAs. aegPNA components are shown with grey overlay, pePNA components with C3-phosphonic-ester (R1) side chains are shown in red letters, those with lysine-phosphonic-ester (R2) side chains in red overlay. Boxed bases represent mismatches. All PNA and morpholino oligonucleotides are shown in 3′-5′ orientation. L represents a trimethyl-lysine and K a dimethyl-lysine

Fig. 3
figure 3

Loss of function phenotypes for the tcf3 gene in medaka. Embryos at the 1-cell stage were co-injected with 300 μM morpholino oligonucleotide (Tcf3MO) and 1 μg/mL FITC-dextran. The pairs b and f, c and g, d and h each show the same embryo at different stages (stage 22, a-d; stage 30, e-h). Control embryos (a,e) were co-injected with 1× Yamamoto’s and FITC-dextran. Pictures of embryos with a fluorescent signal were taken at the indicated stages. Classification was performed after the onset of eye pigmentation, according to the size of the eye: (b,f) weak, slightly reduced size; (c,g) moderate, severe size reduction; (d,h) strong, eye-less. Embryos at stage 16 (i-k, n-o) are shown in dorsal view, anterior to the top; except for (l,p) which are at stage 17 and shown in lateral view. For genotypic analysis (i-p), whole mount in situ hybridization experiments were performed on MO injected embryos and un-injected wild type controls at stage 16 using digoxigenin-labelled RNA probes against pax6 (i,m), pax2 (j,n), gbx1 (k,o), and wnt1 (l,p) at stage 17. (i-k, m-o) Broken lines indicate the outlines of the prospective neural domain estimated from the merged expression patterns formed by pax6, pax2 and gbx1 in wild type embryos (i-k). An anterior shift of the expression domains was observed for all four genes. (l,p; arrowhead) wnt1 expression in the mid-hindbrain boundary. Scale bars 100 μm; a, a-h; i, i-k and m-o; l, l and p. Abbreviations: MO, morpholino oligonucleotide

To further characterize the tcf3 loss-of-function phenotype, we next examined the expression of pax2, pax6, gbx1 and wnt1 (Fig. 3i-p), which is known to be affected by Tcf3 activity [20]. In those embryos the expression domains of all three genes were shifted anteriorly (Fig. 3m-o) compared to the wild type control embryos (Fig. 3i-k). In 48% of the embryos (n = 61) the expression domain of the forebrain marker pax6 was smaller (Fig. 3m) and instead of two separate domains on either side of the prospective head (Fig. 3i), only a single cap-like structure was observed at the most anterior region of the prospective neural domain (Fig. 3m). However, we did not see a complete loss of anterior pax6 expression. The expression of pax2, a marker of the MHB, was shifted anteriorly in 56% of the morphants (n = 36), partially overlapping with the pax6 domain (Fig. 3n) which is in good agreement with the expression pattern found in zebrafish hdl mutants [20]. In 37% of the embryos (n = 43) an altered expression of the hindbrain marker gbx1 was observed, where again the entire expression domain was shifted anteriorly (Fig. 3o). In addition, the lateral edges of less severely caudalized embryos pointed anteriorly and in more severe phenotypes, the expression expanded into an arc-like shape, thereby overlapping with the expression domains of both pax6 and pax2. We also analysed the MHB marker wnt1 in tcf3 knockdown embryos and found expression in a more anterior position (Fig. 3b). Taken together, the expression of all marker genes clearly indicates the expected anterior shift for tcf3 inactivation.

Improvement of PNA specificity

Qualification of the pigmented retinal structures of the eyes allowed a simple but reliable phenotype classification. Based on these results we could compare the knockdown efficiency of the different antisense molecules. We first used a mixed pePNA (Tcf3PNA), which contains two tri-methyl-lysine (TML) terminal groups. For each concentration the number of phenotypes of the different groups was determined and the total number of tcf3 knockdown phenotypes among the surviving embryos was calculated (Fig. 4a and Additional file 1). Between 100 μM and 400 μM of Tcf3PNA the total number of phenotypes increased from 22% to 51%. At 600 μM and 900 μM the overall frequency of phenotypes (both 57%) and also the number of dead embryos (6% and 7%, respectively) remained unchanged, which indicates a low toxicity. At 1200 μM the percentage of tcf3-specific phenotypes increased to 86%, however, the mortality rate also increased to 38%, indicating elevated toxicity of the PNA at higher concentrations. As expected, these increasing numbers of phenotypes also resulted in a continuous shift from preferentially weak phenotypes at low concentrations to a high proportion of strong phenotypes at high concentrations (Additional file 1). The morpholino oligonucleotide showed phenotypes indistinguishable from the pePNAs, but differed in their efficiency. High rates of tcf3-specific phenotypes, 71% and 92%, already appeared at low concentrations, 50 μM and 100 μM, respectively. However, at 200 μM the mortality rate jumped to 44%, indicating toxic effects (Fig. 4b and Additional file 1). At concentrations with high mortality rates, some embryos with unspecific phenotypes appeared which looked similar for both pePNAs and morpholino oligonucleotides. We previously described such unspecifically affected medaka embryos, which have smaller eyes but show severe defects over the entire brain [9]. Such unspecific phenotypes were not detected at non-toxic concentrations. Taken together, the morpholino oligonucleotide was more efficient than the pePNA at low concentrations, but also showed higher toxicity.

Fig. 4
figure 4

Knockdown efficiencies using modified PNAs. Quantitative evaluation of tcf3 knockdown experiments. Results for injection of the indicated antisense molecules at the indicated concentrations. The blue bars represent the percentage of embryos with phenotypes among the surviving embryos, the red bars represents the mortality rate (see also Additional file 1)

Thereafter, we tested the pePNAs’ splice blocking efficiency. A sequence overlapping with both exon 1 and intron 1 was selected and also synthesized as a mixed PNA with a double TML end group (Tcf3spPNA; Fig. 2b). The result of this splice block is a truncated and therefore non-functional protein. Upon PNA injection the same phenotypes were observed as were found for Tcf3PNA, however, with lower efficiency (Fig. 4a and Additional file 1). The highest number of specifically affected embryos (49%) was observed at a concentration of 900 μM. At 1200 μM toxicity became dominant, similar to that seen for Tcf3PNA. We reasoned that a combination of both the translational blocking and the splice blocking PNAs might result in an improved knockdown efficiency. Indeed, co-injection of Tcf3PNA and Tcf3spPNA, each at a concentration of 200 μM, resulted in 50% of the embryos showing phenotypes (Fig. 4a and Additional file 1), which is higher than the percentage of affected embryos for both 400 μM Tcf3PNA (39%) and 400 μM Tcf3spPNA (30%). Therefore, the combined injection of both PNAs led to a synergistic improvement, which was also observed at higher concentrations. At 900 μM (450 μM each) 74% of the embryos showed tcf3-specific phenotypes without toxic side effects (those first appeared at 1200 μM).

We then tested lysine-phosphonic-ester (lpe) side chains as a novel backbone modification of the PNAs (Fig. 2a). A mixed 16mer PNA with the same target sequence as Tcf3PNA was synthesized (Tcf3kPNA; Fig. 2b). Injection of these new PNAs resulted in identical tcf3 specific phenotypes, but in considerably higher numbers (Fig. 4b and Additional file 1). At 100 μM the Tcf3kPNA produced 76% tcf3 specific phenotypes, compared to 22% for the Tcf3PNA. Similar improvements were also seen for other concentrations. A peak level of 92% phenotypes was observed at 400 μM with the first toxic effects of these modified PNAs appearing at 600 μM. Therefore, the lpe-side chain modification strongly improved the antisense efficiency of PNAs. To test specificity, a two nucleotide substitution was introduced (GT to TG at positions 8 and 9 of the PNA; Tcf3kPNAmut Fig. 2b). This substitution resulted in a dramatic loss of the tcf3 knockdown phenotypes (Fig. 4b and Additional file 1). At 100 μM none of the embryos showed tcf3-specific phenotypes and at 600 μM only 11% did (compared to 93% for the non-mutated version). Therefore, a highly specific antisense function of the K-modified PNAs in an in vivo environment could be observed at low concentrations, directly comparable to the results for morpholino oligonucleotides. Taken together, the repeated appearance of the same phenotypes with various different antisense molecules clearly demonstrated specificity of the tcf3 knockdown experiments.

Tcf3 function in eye development is mediated by Groucho/Tle interaction

In order to understand the effect of Tcf3 misexpression during embryogenesis, we injected a heat-inducible tcf3 construct into the blastomere of one-cell stage wild-type embryos. The heat-inducible promoter allowed us a stage-dependent gain-of-function analysis [28]. We first performed heat treatment at mid-gastrulation (stage 14/15) and analyzed the injected embryos after the onset of eye pigmentation at stage 30. In this context, 31% (n = 27) of the injected embryos showed reduced eye size and 8% lacked eyes; neither varying DNA concentration nor heat-induction time altered the eye phenotypes. Hence, based on our results gain-of-function and loss-of-function experiments for tcf3 resulted in similar phenotypes.

We subsequently focused on the functional domains of Tcf3 which mediate transcriptional repression. More precisely, the Tcf3 protein contains two repression domains: a CtBP interaction domain at the C-terminus [29] and a Groucho/Tle interaction domain at the N-terminus [24] (Fig. 5a). We therefore constructed differently truncated tcf3 cDNAs that either lack the CtBP interaction domain (Tcf3 (1-434)), or both the CtBP and the Groucho/Tle interaction domain (Tcf3 (1-434)ΔGro). Injection of Tcf3 (1-434) cDNA lacking the CtBP binding site, increased the frequency of embryos showing eye phenotypes to 26% (Fig. 5f) compared to 8% for the full-length Tcf3 construct. This indicates that CtBP interaction does not increase eye phenotypes, but instead reduces them. On the other hand, injection of the truncated tcf3 cDNA lacking both the CtBP- and Groucho/Tle interaction domains (Tcf3 (1-434)ΔGro), resulted in a significantly reduced frequency of embryos with strong eye phenotypes (5%), which suggests that the Groucho/Tle interaction of Tcf3 is more important for eye development than that with CtBP is.

Fig. 5
figure 5

tcf3 gain of function phenotypes. a Schematic representation of full length Tcf3, Tcf3 lacking the CtBP binding site (Tcf3[1-434]), and a C-terminally truncated Tcf3 lacking the Groucho/Tle interaction domain (Tcf3[1-434]ΔGro). b-f Embryos at the 1-cell stage were injected with either heat-inducible truncated Tcf3 (Gfp:HSE:Tcf3(1-434); 40 ng/μl) or Tcf3 lacking the Groucho/Tle interaction domain (Gfp:HSE:Tcf3[1-434]ΔGro; 40 ng/μl). Heat induction was performed at stage 14-15. Gfp positive embryos were selected at stage 22 for subsequent whole mount in situ hybridization experiments using digoxigenin-labelled RNA probes against rx2 (c-f). b-e Flat mounts are shown in dorsal view, anterior at the top. Phenotypes were categorized according to their eye size and the expression intensity compared to the control: (c) weak, small eyes, normal expression intensity; (d) small eyes, weak expression; (e), missing eyes and expression. b Heat treated wild type control. f Quantitative results of the injections using rx2 in situ hybridization. Scale bar 100 μm

Additionally, we examined the expression of the retina-specific homeobox gene rx2 in the injected embryos an early stage of eye development [30, 31]. In agreement with the eye phenotypes, three different expression patterns of rx2 were observed in tcf3-injected embryos at stage 21 (Fig. 5b-e). We compared the expression pattern of rx2 in embryos injected either with Tcf3 (1-434) lacking the CtBP binding site or Tcf3 (1-434)ΔGro lacking both the CtBP and the Groucho/Tle interaction domains. The expression of rx2 was less reduced in embryos injected with the Tcf3 construct that lacks the Groucho/Tle interaction domain but still retains the DNA binding- and the ß-catenin interaction domains (Fig. 5f and Additional file 2). In particular, misexpressing this truncated version significantly reduced the appearance of eye phenotypes up to 50% in the injected embryos. Our data therefore suggest that Groucho/Tle co-repressor proteins make a crucial contribution to eye development. Moreover, in addition to eye phenotypes, 21% (n = 66) of Tcf3(1-434)ΔGro injected embryos exhibited ectopic otic vesicles (Additional file 2B,C). We observed ectopic otic vesicles in the trunk and tail regions of the developing embryos, hence, posterior to the endogenous vesicles (Additional file 2C). Taken together, our results suggest that Tcf3 function in eye development is modulated by the Groucho/Tle corepressor interaction.

Two Groucho/Tle genes, tle1 and tle2b, have redundant functions in eye development

Groucho/Tle co-repressor proteins have been implicated in eye development [32, 33]. Particularly Tle1 and Aes were shown to interact with the transcription factors Six3 and Six6 during early eye development [33]. However, several groucho/tle genes are broadly expressed in various developing tissues [34]. Thus, in order to interfere with the function of all Groucho/Tle proteins within one experiment we selected a dominant negative strategy and used a truncated form of Tle4 that contains only the Q domain. The Tle-Q domain is sufficient for interaction with Lef/Tcf proteins and forms a tetrameter upon binding to Lef1 [22]. The Aes protein, which is a truncated member of the Groucho/Tle family, contains only the N-terminal Q and GP domains (Fig. 6a). It has been used repeatedly as a dominant negative form for Groucho/Tle proteins [24, 35] forming intra- as well as intermolecular interactions with other Groucho/Tle proteins via its Q-domain. The resulting tetramers therefore will partially lack the C-terminal domains, which are not present in the Aes protein. Most important at the C-terminus are the domains of WD40 repeats which represent a major protein-protein interaction domain. Inefficient complex formation is therefore the consequence of Aes expression. However, a major criticism of this strategy is that important interactions also originate from the Q-domain. Compared to other Groucho/Tle family members, the Aes Q-domain shows a number of deviations in its amino acid sequence. It is therefore not clear how efficiently the Aes Q-domain can contribute to the interactions in a mixed protein complex. To address this issue, we tested the effect of Aes overexpression on an established Q-domain interaction. For this we selected the Tle-Six3 interaction, which has been shown to be critical for eye development [33], and performed mammalian two-hybrid experiments. Our results showed a stepwise reduction of both Tle1- and Tle4-Six3 complex formation upon increasing Aes concentrations, whereas a control interaction was not affected (Additional file 3). This indicates that Aes overexpression can interfere with both N- and C-terminal interactions of Groucho/Tle proteins in the mixed complexes.

Fig. 6
figure 6

Aes-mediated Groucho/Tle loss of function phenotypes. a Schematized presentation of full length Tle protein, the Q-domain, and Aes. For transgenic lines, embryos at the 1-cell stage were injected with 20 ng/μl of DNA (Gfp:HSE:Aes and Gfp:HSE:Q). The F1 generation was heat-induced (10 min, 43.5 °C) at stage 15/16. b-k Embryos are shown in dorsal view, anterior to the top. f-k Flat mounts. c-d Phenotypes of the Aes/Q-mediated Groucho/Tle loss of function were categorized according to their eye phenotype into: (c-c″) weak, smaller eyes tilted towards the midline; (d-d”) moderate, beginning cyclopia anterior; strong (e-e”), cyclopic eye. For whole mount in situ hybridization experiments (f-k), using the indicated digoxigenin-labelled RNA probes, fixation was performed at stage 21; heat treatment occurred as described before. i rx2 expression indicates a reduction in eye size, the eyes are tilted at the anterior end towards the midline (arrowheads); (j) Bf1 expression is reduced; (k) Wnt1 expression indicates a reduction in midbrain size. Instead of a defined expression close to the midline (h, arrows), Aes misexpression resulted in an indistinct expression pattern throughout the midbrain (K, arrows). (b-b″, f-h) control embryos were heat-treated wild type embryos. Scale bars 100 μm; b, b-e”; f, f-k

Based on these data we generated two heat-inducible transgenic lines for misexpression of Aes (HSE:Aes) and the Tle4-Q domain (HSE:Q). We then performed heat shock at mid gastrula stage and analysed the embryos over the following days (Fig. 6b-e). In agreement with previous studies we observed eye phenotypes [32, 33]. Interestingly in both transgenic lines a range of phenotypes appeared which might be explained by variations of the heat shock induction and the dependence of the dominant negative approach on the resulting expression levels. We used a phenotype classification scheme similar to the previous one. Embryos with a weak phenotype developed slightly smaller eyes which point towards the midline (Fig. 6c-c”), whereas embryos with a strong phenotype showed cyclopic eyes (Fig. 6e-e”). As a moderate phenotype we considered embryos between these extremes (Fig. 6d-d”). Here, additionally to the weak phenotype, the lenses were shifted anteriorly and mild cyclopia anterior of the forebrain was observed. In HSE:Aes embryos a total of 24% developed a phenotype (n = 97), equally distributed between weak and strong. The HSE:Q line showed a total of 34% phenotypes among the induced embryos (n = 79), however, only 5% of the embryos were categorized as having a strong phenotype. Therefore, the interference of the Q-domain was less efficient compared to the aes-misexpressing line, but interestingly the phenotypes were identical. We then analysed the expression pattern of marker genes for retina (rx2), telencephalon (bf1) and midbrain (wnt1) development in the transgenic embryos at stage 21 (Fig. 6f-k). Supporting the eye phenotypes, the expression of rx2 was present but restricted to eye size (Fig. 6i). In embryos with a strong phenotype, an additional faint stripe of rx2 expression that connected the two optic vesicles was observed in the forebrain. In those embryos the expression of bf1 was also impaired (Fig. 6j). Furthermore, the expression of wnt1 indicated a slight reduction in the size of the midbrain (Fig. 6k).

In order to elucidate which of the groucho/tle genes are involved in eye development we specifically impaired the function of individual genes using antisense oligonucleotides. In medaka, six full length members of the groucho/tle family were described; most of them are expressed in largely overlapping domains indicating that they might have redundant functions [34]. We selected three groucho/tle paralogs (tle1, tle2b and tle3b) that are specifically expressed in the optic placode [33, 34]. Interestingly, we observed similar eye phenotypes for all three genes. According to our phenotype classification 10%-16% of the morphants showed eye defects (for more details see Additional file 4), in which the tle2b-morphants showed the highest frequencies in strong- (16%, n = 237) and eye-less (7%) phenotypes. We next tested combined inactivation and observed an additive effect in tle1-tle2b morphants (27%, n = 44) but not in triple morphants (17%, n = 58). The appearance of eye defects in tle morphants fully supported our transgenic HSE:aes and HSE:Q results. Nevertheless, we observed some slightly different phenotypes resulting from these two approaches, in particular the cyclopic eye connection in the tle1 morphants appeared in the middle of the eyes (see Additional file 4C), whereas these connections were preferentially observed anterior to the forebrain in the transgenic HSE:Aes and HSE:Q embryos (Fig. 6d”).

Discussion

Knockdown of the tcf3 gene in medaka resembles the zebrafish hdl/tcf3b double morphants

The expression and function of tcf3 in medaka is poorly understood. In contrast to zebrafish, medaka has only a single tcf3 gene (this study and [27]), however the expression pattern closely resembled that of the zebrafish hdl and tcf3b genes (Fig. 1; [19, 20]). It was therefore not surprising that the phenotype of medaka tcf3 morphants resembled the combined inactivation of both zebrafish tcf3 paralogs (e.g. complete lack of eyes and anterior brain defects). Knockdown of medaka tcf3 resulted either in weakly or moderately affected embryos with reduced eye size, covering the range of phenotypes that have been seen for inactivation of single tcf3 genes in zebrafish, or in strongly affected eye-less embryos corresponding to the complete absence of Tcf3 proteins in zebrafish hdl/tcf3b double morphants (Fig. 3). The analysis of marker gene expression in the tcf3 morphants verifies the strong effect on the Tcf3/Wnt gradient along the AP axis [36, 37], all marker genes tested in this study showed an anterior shift centering on the position of the prechordal plate. These anterior defects are also in good agreement with the AP defects seen in Wnt1 overexpression experiments [38]. Dorsky and colleagues analyzed the expression of these genes in zebrafish upon tcf3 inactivation. Hdl mutants showed a decrease in pax6 expression in the presumptive head region and pax2.1 expression was expanded rostrally, whereas the gbx1 domain remained unchanged. However, if both hdl and tcf3b were inactivated, gbx1 also expanded anteriorly, thereby including the expression domain of pax2.1, and the anterior expression of pax6 was completely lost [20]. This stepwise reduction of Tcf3 activity in zebrafish resulted in a progressive anterior shift of the marker genes centring on the position of the prechordal plate [36]. Taken together, a single tcf3 gene in medaka combines the function of the two tcf3 paralogous genes in zebrafish.

Novel side chains provide higher antisense efficiency for PNAs

In this study, we also applied PNAs for tcf3 knockdown experiments in medaka embryos. We used phosphonic ester modified mixed PNAs, which previously were shown to be suitable for loss-of-function experiments in medaka [9]. Here again we could demonstrate a specific knockdown of gene function. Initially we used pePNAs with two TML end groups and obtained almost 60% specific phenotypes (400 to 900 μM) (Fig. 4a and Additional file 1). At higher concentrations this percentage further increased, however, also unspecific toxicity was observed. The pePNA molecules were also effective in a splice-blocking approach. Although the efficiency was lower compared to the translational blocking experiments, the same tcf3 specific phenotypes appeared (Fig. 4a and Additional file 1). Furthermore, a combined injection of both PNAs synergistically improved the overall efficiency of the antisense molecules (74% specific phenotypes).

Morpholino oligonucleotides resulted in higher efficiency when directly compared with pePNAs (e.g. 92% and 22% phenotypes at 100 μM, respectively). However, also toxic effects started at considerably lower concentrations (200 μM and 1200 μM, respectively). Otherwise, the obtained phenotypes were identical for the two antisense molecules (Fig. 4b and Additional file 1). Interestingly, further modification of the PNA backbone with lpe-side chains (Fig. 2a) considerably improved the PNA efficiency (Fig. 4b and Additional file 1). At concentrations of 50 μM to 400 μM, 63% to 92% of the embryos showed tcf3 specific phenotypes (with toxicity first appearing at 600 μM). This efficiency is in the same range as that for the morpholino oligonucleotides. An exchange of 2 nucleotides in this sequence (GT to TG at positions 8 and 9) resulted in a dramatic drop in phenotypes (8% to 16% phenotypes at 100 μM to 400 μM), thus demonstrating the high specificity of this 16mer PNA. Therefore, novel side chain modifications efficiently improved the in vivo antisense function of PNAs.

Groucho/Tle corepressor proteins are critical for Tcf3 function in eye development

The Tcf3 protein has two major co-repressor interaction domains; an amino-terminally located domain that interacts with Groucho/Tle proteins [24] and a carboxy-terminal domain that interacts with the CtBP protein [29]. Our results indicate that the CtBP interacting domain in Tcf3 is dispensable for early embryonic eye development; indicating that the interaction with Groucho/Tle proteins is more crucial. In particular, Tcf3 variants lacking the Groucho/Tle interaction domain showed considerably reduced numbers of eye phenotypes in our gain-of-function experiments. These results further support the idea that the Groucho/Tle co-repressors are required for eye development [33, 39].

To interfere with the function of all Groucho/Tle proteins we used three strategies. Firstly, we misexpressed the aes gene. Aes (Fig. 6) is a naturally occurring truncated family member of full-length Groucho/Tle proteins that consists of only the Q and the GP domains [25, 26, 40]. The Q domain allows Aes to oligomerize with full-length Groucho/Tle proteins, thereby reducing the number of C-terminal interaction domains [21, 33, 41,42,43,44,45]. The GP domain, however, is functionally different from full-length Groucho/Tle proteins since it does not interact with HDAC co-repressors [13, 39, 46, 47]. It was therefore suggested that through this interaction Aes turns Groucho/Tle oligomers into non-functional complexes, which therefore have a reduced number of C-terminal WD-40 interaction domains and a reduced efficiency to cooperate with HDAC co-repressors [21, 41, 42, 44, 48, 49]. Supportive of this hypothesis, our mammalian two-hybrid experiments using the Six3 transcription factor, indicated that additionally N-terminal interactions with the Q-domain are blocked by Aes misexpression. Indeed, ectopic expression of Aes in medaka resulted in considerably smaller eyes and otic vesicles and reduced expression of optic and otic marker genes, suggesting an efficient block of Groucho/Tle activity [32, 33]. In addition to the Groucho/Tle blocking functions, Aes is also known to exhibit specific functions on its own in certain cellular contexts [46, 50, 51]. The observed phenotypes could therefore be a mixture between groucho/tle loss-of-function and aes gain-of-function effects. Secondly, we misexpressed the Tle4 Q-domain and could phenocopy the Aes misexpression embryos, however, at a lower efficiency. The reduction of the bf1 and wnt1 expression field in the forebrain and midbrain in those embryos also confirmed the observed phenotypes and is in agreement with a previous study in Xenopus [52]. Finally, we analysed the function of groucho/tle genes by injection of morpholino oligonucleotides. Previously, we have shown that three paralogs of medaka groucho/tle genes (tle1, tle2b and tle3b) are expressed during early eye development [34]. Interestingly, knockdown of each of these genes, individually or in combination, resulted in specific impairment of eye development which suggests redundancy. These phenotypes closely resembled those of the dominant negative experiments and thus fully support this approach.

In addition to eye phenotypes, we also observed ectopic otic vesicles in the Tcf3[1-434]ΔGro- injected embryos. The appearance of ectopic otic vesicles might be caused by a dominant negative effect of the overexpressed truncated Tcf3, thus blocking the repressing function of full-length Tcf3. Such an anti-repressive effect would be equivalent to ectopic Wnt activation. Indeed, we have previously shown that induction of Wnt signaling leads to the formation of ectopic otic vesicles [38, 53].

Conclusion

Taken together, our results suggest that a single tcf3 gene in medaka is crucial for eye development and its function is modulated by interaction with Groucho/Tle co-repressor proteins. Gain-of-function analyses of Aes and the Q-domain, as dominant negative effectors, together with the loss-of-function analyses of individual tle genes confirm this interpretation. Moreover, our results indicate that three tle genes (tle1, tle2b and tle3b) might have redundant functions during eye development.

Methods

PNA and morpholino oligonucleotide synthesis

Lysine-phosphonic-ester Ugi-PNA monomers were synthesized according to the following process. First, an N-Cbz or N-Boc protected phosphono glycinate was reacted with the appropriate aldehyde in a Horner- Wadsworth-Emmons [54,55,56] followed by enantioselective hydrogenation using Burk’s catalyst [57,58,59] to give the α-substituted protected glycinate. Deprotection of the α-amino function and subsequent reductive amination with N-Boc-amino acetaldehyde gave the Ugi-PNA-monomer backbone. The latter was coupled to the appropriate protected nucleobase acetic acid component, employing HATU as coupling reagent. Finally, deprotection of the carboxylic function yielded the Ugi PNA monomer. Synthesis of the C3-phosphonic-ester-Ugi-PNA monomer building blocks was performed as described previously [9]. The PNAs were dissolved to 1 mM in nuclease free water by repeated shaking and vortexting. Finally they were gently sonicated for 2 min with repeated pulses. Subsequently the PNAs were kept at −80 °C. Phosphorodiamidate morpholino oligonucleotides (abbreviated here as morpholinos) were manufactured by Gene Tools (see Fig. 3). Morpholino sequences for the tle genes in 5′-3′ direction: tle1, CGCGTCTTGTCCTGAAACCCCGCTA; tle2b, GGCAGTGCGTCCTCGTGGCTCTTTC; tle3b, CGGCCTTGTGGATACATGTCTCGTC. For injection into medaka embryos, morpholinos were dissolved in 1× Yamamoto’s Ringer solution at the indicated concentration and injected into the blastomere at the one-cell stage.

DNA constructs

All DNA constructs for microinjection were under the control of a bi-directional heat-inducible promoter [28] and contained either the mouse Aes/Grg5 cDNA, the mouse Tle4 Q domain (AA 1-135), or various deletion fragments of Tcf3 cDNA (see Fig. 5 for details). For cell culture experiments pMC [60] and pKC (polylinker modification of pKW) [61] were used (both vectors contain cytomegalovirus promoters). pLucF24ZF; luciferase reporter under the control of a Fos minimal promoter and ZFHD binding sites. pMChSix3(85-203)mZFb6; the human Six3 fragment (positions of amino acids in brackets) fused to a ZFHD DNA binding domain [62] and the “base” leucine-zipper [63]. pMCTle1VP16 and pMCTle4VP16; human Tle1 and mouse Tle4 were fused to the transcriptional activation domain of the herpes simplex virus protein VP16, respectively. pMCacidVP16 contains the “acid” leucine-zipper fused to VP16, pKCAes the mouse Aes/Grg5 cDNA.

Microinjection into medaka embryos

Embryos of the medaka Cab strain were used for all experiments. Adult fish were maintained at 26 °C with an artificial 14 h light and 10 h dark cycle. Stages were determined according to the morphological markers described in Iwamatsu [64]. DNA constructs were co-injected with I-SceI meganuclease enzyme (0.5 U/μl) at the one-cell stage. For transient studies, different versions of truncated tcf3 cDNAs (HSE:tcf3 constructs) were injected at a concentration of 40 ng/μl. For the generation of a heat-inducible aes (HSE:aes) and Q-domain (HSE:Q) transgenic lines, DNA constructs were injected at 10 ng/μl concentration together with I-SceI meganuclease enzyme. The embryos were incubated at normal conditions (1× ERM buffer at 27 °C). Heat treatment was performed at stage 14 (except if otherwise indicated) for 10 min at 43.5 °C. For co-injection experiments FITC-dextran (FD10S, Sigma-Aldrich) was used.

Whole-mount in situ hybridization

Whole-mount in situ hybridization using DIG-labelled RNA probes was performed as described previously [34]. Probes against tcf3 (Ensembl: ENSORLT00000014810) and gbx1 (Ensembl: ENSORLT00000021915) were PCR amplified from medaka embryonic cDNA using specific primers for tcf3 (5’-CGGATCCATGGCTCAACTGAACGGAGGC-3′ and 5’-CGAAGACGGCTGGACATGGATGCATTCA-3′) and gbx1 (5’-TTAGAAAATACAGCCACAA-3′ and 5’-TCACTGTAAAAAGTACCTG-3′). The expression patterns of pax6 [65], pax2 [66], wnt1 [67], rx2 [30] and bf1 [68] were described previously.

Cell culture and mammalian two-hybrid assay

HeLa cells (300,194, Cell Line Services) were transfected in polyethylenimine (2.5 μg/ml) coated 96-well plates [69] using TurboFect transfection reagent according to the instructions of the manufacturer (Thermo Scientific). For luciferase activity detection, additional transfection of 2 ng Gaussia luciferase expression vector pMCGlucS served as an internal reference. Luciferase activities were measured 24 h after transfection. For the mammalian two-hybrid assay, cells were co-transfected with 70 ng of firefly luciferase reporter construct pLucF24ZF, 20 ng of Six3 expressing plasmid pMChSix3(85-203)mZFbase (six-domain of human Six3), 0-6 ng of Aes expressing plasmid pKCAes, and 20 ng of either pMCTle1VP16, Tle4 pMCTle4VP16 or the control pMCacidVP16.

Abbreviations

aegPNA:

N-[2-aminoethyl]-glycine PNA

AP:

Anterior-posterior

lpe:

Lysine-phosphonic-ester

MHB:

Mid-hindbrain boundary

MO:

Morpholino oligonucleotide

pePNA:

Phosphonic ester PNA

PNA:

Peptide Nucleic Acid

TML:

Tri-methyl-lysine

References

  1. Summerton JE. Morpholinos and PNAs compared. Lett Pept Sci. 2003;10:215–36.

    Article  CAS  Google Scholar 

  2. Summerton J. Morpholino antisense oligomers: the case for an RNase H-independent structural type. Biochim. Biophys. Acta - gene Struct. Expr. 1999;1489:141–58.

    CAS  Google Scholar 

  3. Nielsen PE, Egholm M, Berg RH, Buchardt O. Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide. Science. 1991;254:1497–500.

    Article  CAS  Google Scholar 

  4. Buchardt O, Egholm M, Berg RH, Nielsen PE. Peptide nucleic acids and their potential applications in biotechnology. Trends Biotechnol. 1993;11:384–6.

    Article  CAS  Google Scholar 

  5. Egholm M, Buchardt O, Christensen L, Behrens C, Freier SM, Driver DA, et al. PNA hybridizes to complementary oligonucleotides obeying the Watson-crick hydrogen-bonding rules. Nature. 1993;365:566–8.

    Article  CAS  Google Scholar 

  6. Ray A, Nordén B. Peptide nucleic acid (PNA): its medical and biotechnical applications and promise for the future. FASEB J. 2000;14:1041–60.

    CAS  Google Scholar 

  7. Nielsen PE, Haaima G, Lohse A, Buchardt O. Peptide nucleic acids(PNAs) containing thymine monomers derived from Chiral amino acids: hybridization and solubility properties OfD-lysine PNA. Angew Chemie Int Ed English. 1996;35:1939–42.

    Article  Google Scholar 

  8. Urtishak KA, Choob M, Tian X, Sternheim N, Talbot WS, Wickstrom E, et al. Targeted gene knockdown in zebrafish using negatively charged peptide nucleic acid mimics. Dev Dyn. 2003;228:405–13.

    Article  CAS  Google Scholar 

  9. Dorn S, Aghaallaei N, Jung G, Bajoghli B, Werner B, Bock H, et al. Side chain modified peptide nucleic acids (PNA) for knock-down of six3 in medaka embryos. BMC Biotechnol. 2012;12:50.

    Article  CAS  Google Scholar 

  10. van de Wetering M, Oosterwegel M, Dooijes D, Clevers H. Identification and cloning of TCF-1, a T lymphocyte-specific transcription factor containing a sequence-specific HMG box. EMBO J. 1991;10:123–32.

    CAS  Google Scholar 

  11. Arce L, Yokoyama NN, Waterman ML. Diversity of LEF/TCF action in development and disease. Oncogene. 2006;25:7492–504.

    Article  CAS  Google Scholar 

  12. Behrens J, von Kries JP, Kühl M, Bruhn L, Wedlich D, Grosschedl R, et al. Functional interaction of beta-catenin with the transcription factor LEF-1. Nature. 1996;382:638–42.

    Article  CAS  Google Scholar 

  13. Arce L, Pate KT, Waterman ML. Groucho binds two conserved regions of LEF-1 for HDAC-dependent repression. BMC Cancer. 2009;9:159.

    Article  Google Scholar 

  14. Kengaku M, Capdevila J, Rodriguez-Esteban C, De La Peña J, Johnson RL, Izpisúa Belmonte JC, et al. Distinct WNT pathways regulating AER formation and dorsoventral polarity in the chick limb bud. Science. 1998;280:1274–7.

    Article  CAS  Google Scholar 

  15. Houston DW, Kofron M, Resnik E, Langland R, Destree O, Wylie C, et al. Repression of organizer genes in dorsal and ventral Xenopus cells mediated by maternal XTcf3. Development. 2002;129:4015–25.

    CAS  Google Scholar 

  16. Merrill BJ, Pasolli HA, Polak L, Rendl M, Garcia-Garcia MJ, Anderson KV, et al. Tcf3: a transcriptional regulator of axis induction in the early embryo. Development. 2004;131:263–74.

    Article  CAS  Google Scholar 

  17. Cole MF, Johnstone SE, Newman JJ, Kagey MH, Young RA. Tcf3 is an integral component of the core regulatory circuitry of embryonic stem cells. Genes Dev. 2008;22:746–55.

    Article  CAS  Google Scholar 

  18. Pereira L, Yi F, Merrill BJ. Repression of Nanog gene transcription by Tcf3 limits embryonic stem cell self-renewal. Mol Cell Biol. 2006;26:7479–91.

    Article  CAS  Google Scholar 

  19. Kim CH, Oda T, Itoh M, Jiang D, Artinger KB, Chandrasekharappa SC, et al. Repressor activity of headless/Tcf3 is essential for vertebrate head formation. Nature. 2000;407:913–6.

    Article  CAS  Google Scholar 

  20. Dorsky RI, Itoh M, Moon RT, Chitnis A. Two tcf3 genes cooperate to pattern the zebrafish brain. Development. 2003;130:1937–47.

    Article  CAS  Google Scholar 

  21. Brantjes H, Roose J, Van De Wetering M, Clevers H. All Tcf HMG box transcription factors interact with Groucho-related co-repressors. Nucleic Acids Res. 2001;29:1410–9.

    Article  CAS  Google Scholar 

  22. Daniels DL, Weis WI. Beta-catenin directly displaces Groucho/TLE repressors from Tcf/Lef in Wnt-mediated transcription activation. Nat Struct Mol Biol. 2005;12:364–71.

    Article  CAS  Google Scholar 

  23. Turki-Judeh W, Courey AJ. The Unconserved Groucho central region is essential for viability and modulates target gene specificity. PLoS One. 2012;7:e30610.

    Article  CAS  Google Scholar 

  24. Roose J, Molenaar M, Peterson J, Hurenkamp J, Brantjes H, Moerer P, et al. The Xenopus Wnt effector XTcf-3 interacts with Groucho-related transcriptional repressors. Nature. 1998;395:608–12.

    Article  CAS  Google Scholar 

  25. Mallo M, Franco del Amo F, Gridley T. Cloning and developmental expression of Grg, a mouse gene related to the groucho transcript of the drosophila enhancer of split complex. Mech Dev. 1993;42:67–76.

    Article  CAS  Google Scholar 

  26. Schmidt CJ, Sladek TE. A rat homolog of the drosophila enhancer of split (groucho) locus lacking WD-40 repeats. J Biol Chem. 1993;268:25681–6.

    CAS  Google Scholar 

  27. Wang D, Manali D, Wang T, Bhat N, Hong N, Li Z, et al. Identification of pluripotency genes in the fish medaka. Int J Biol Sci. 2011;7:440–51.

    Article  CAS  Google Scholar 

  28. Bajoghli B, Aghaallaei N, Heimbucher T, Czerny T. An artificial promoter construct for heat-inducible misexpression during fish embryogenesis. Dev Biol. 2004;271:416–30.

    Article  CAS  Google Scholar 

  29. Brannon M, Brown JD, Bates R, Kimelman D, Moon RT. XCtBP is a XTcf-3 co-repressor with roles throughout Xenopus development. Development. 1999;126:3159–70.

    CAS  Google Scholar 

  30. Loosli F, Winkler S, Wittbrodt J. Six3 overexpression initiates the formation of ectopic retina. Genes Dev. 1999;13:649–54.

    Article  CAS  Google Scholar 

  31. Mathers PH, Grinberg A, Mahon KA, Jamrich M. The Rx homeobox gene is essential for vertebrate eye development. Nature. 1997;387:603–7.

    Article  CAS  Google Scholar 

  32. Bajoghli B, Aghaallaei N, Czerny T. Groucho corepressor proteins regulate otic vesicle outgrowth. Dev Dyn. 2005;233:760–71.

    Article  CAS  Google Scholar 

  33. Lopez-Rios J, Tessmar K, Loosli F, Wittbrodt J, Bovolenta P. Six3 and Six6 activity is modulated by members of the groucho family. Development. 2003;130:185–95.

    Article  CAS  Google Scholar 

  34. Aghaallaei N, Bajoghli B, Walter I, Czerny T. Duplicated members of the Groucho/Tle gene family in fish. Dev Dyn. 2005;234:143–50.

    Article  CAS  Google Scholar 

  35. Muhr J, Andersson E, Persson M, Jessell TM, Ericson J. Groucho-mediated transcriptional repression establishes progenitor cell pattern and neuronal fate in the ventral neural tube. Cell. 2001;104:861–73.

    Article  CAS  Google Scholar 

  36. Chitnis AB, Itoh M. Exploring alternative models of rostral-caudal patterning in the zebrafish neurectoderm with computer simulations. Curr Opin Genet Dev. 2004;14:415–21.

    Article  CAS  Google Scholar 

  37. Kiecker C, Niehrs C. A morphogen gradient of Wnt/beta-catenin signalling regulates anteroposterior neural patterning in Xenopus. Development. 2001;128:4189–201.

    CAS  Google Scholar 

  38. Bajoghli B, Aghaallaei N, Jung G, Czerny T. Induction of otic structures by canonical Wnt signalling in medaka. Dev Genes Evol. 2009;219:391–8.

    Article  CAS  Google Scholar 

  39. Bajoghli B, Aghaallaei N, Soroldoni D, Czerny T. The roles of Groucho/Tle in left-right asymmetry and Kupffer’s vesicle organogenesis. Dev Biol. 2007;303:347–61.

    Article  CAS  Google Scholar 

  40. Miyasaka H, Choudhury BK, Hou EW, Li SS. Molecular cloning and expression of mouse and human cDNA encoding AES and ESG proteins with strong similarity to drosophila enhancer of split groucho protein. Eur J Biochem. 1993;216:343–52.

    Article  CAS  Google Scholar 

  41. Chen G, Nguyen PH, Courey AJ. A role for Groucho tetramerization in transcriptional repression. Mol Cell Biol. 1998;18:7259–68.

    Article  CAS  Google Scholar 

  42. Choi CY, Kim YH, Kwon HJ, Kim Y. The homeodomain protein NK-3 recruits Groucho and a histone deacetylase complex to repress transcription. J Biol Chem. 1999;274:33194–7.

    Article  CAS  Google Scholar 

  43. Eberhard D, Jiménez G, Heavey B, Busslinger M. Transcriptional repression by Pax5 (BSAP) through interaction with corepressors of the Groucho family. EMBO J. 2000;19:2292–303.

    Article  CAS  Google Scholar 

  44. Pinto M, Lobe CG. Products of the grg (Groucho-related gene) family can dimerize through the amino-terminal Q domain. J Biol Chem. 1996;271:33026–31.

    Article  CAS  Google Scholar 

  45. Yao J, Lai E, Stifani S. The winged-helix protein brain factor 1 interacts with groucho and hes proteins to repress transcription. Mol Cell Biol. 2001;21:1962–72.

    Article  CAS  Google Scholar 

  46. Yu X, Li P, Roeder RG, Wang Z. Inhibition of androgen receptor-mediated transcription by amino-terminal enhancer of split. Mol Cell Biol. 2001;21:4614–25.

    Article  CAS  Google Scholar 

  47. Zhang X, Chen H-M, Jaramillo E, Wang L, D’Mello SR. Histone deacetylase-related protein inhibits AES-mediated neuronal cell death by direct interaction. J Neurosci Res. 2008;86:2423–31.

    Article  CAS  Google Scholar 

  48. Palaparti A, Baratz A, Stifani S. The Groucho/transducin-like enhancer of split transcriptional repressors interact with the genetically defined amino-terminal silencing domain of histone H3. J Biol Chem. 1997;272:26604–10.

    Article  CAS  Google Scholar 

  49. Beagle B, Johnson GV. AES/GRG5: more than just a dominant-negative TLE/GRG family member. Dev Dyn. 2010;239:2795–805.

    Article  CAS  Google Scholar 

  50. Tetsuka T, Uranishi H, Imai H, Ono T, Sonta S, Takahashi N, et al. Inhibition of nuclear factor-kappaB-mediated transcription by association with the amino-terminal enhancer of split, a Groucho-related protein lacking WD40 repeats. J Biol Chem. 2000;275:4383–90.

    Article  CAS  Google Scholar 

  51. Zhang Y, Gao S, Wang Z. Structural and functional analysis of amino-terminal enhancer of split in androgen-receptor-driven transcription. Biochem J. 2010;427:499–511.

    Article  CAS  Google Scholar 

  52. Tsuji S, Hashimoto C. Choice of either beta-catenin or Groucho/TLE as a co-factor for Xtcf-3 determines dorsal-ventral cell fate of diencephalon during Xenopus development. Dev Genes Evol. 2005;215:275–84.

    Article  CAS  Google Scholar 

  53. Jung G, Hug M, Halter C, Friesenhengst A, Walzer J, Czerny T. Diffusion of small molecules into medaka embryos improved by electroporation. BMC Biotechnol. 2013;13:53.

    Article  CAS  Google Scholar 

  54. Boutagy J, Thomas R. Olefin synthesis with organic phosphonate carbanions. Chem Rev Am Chem Soc. 1974;74:87–99.

    Article  CAS  Google Scholar 

  55. Cativiela C, Díaz-de-Villegas MD, Gálvez JA, Su G. Horner–Wadsworth–Emmons reaction for the synthesis of unusual alpha,beta-didehydroamino acids with a chiral axis. ARKIVOC. 2004;2003:59–66.

    Google Scholar 

  56. Wadsworth WS. Synthetic applications of Phosphoryl-stabilized anions. Org. React. Hoboken, NJ, USA: John Wiley & Sons, Inc.; 1977. p. 73–253.

  57. Burk MJ, Feaster JE, Nugent WA, Harlow RL. Preparation and use of C2-symmetric bis(phospholanes): production of .Alpha.-amino acid derivatives via highly enantioselective hydrogenation reactions. J Am Chem Soc. 1993;115:10125–38.

    Article  CAS  Google Scholar 

  58. Cobley CJ, Lennon IC, Praquin C, Zanotti-Gerosa A, Appell RB, Goralski CT, et al. Highly efficient asymmetric hydrogenation of 2-Methylenesuccinamic acid using a Rh-DuPHOS catalyst. Org Process Res Dev. 2003;7:407–11.

    Article  CAS  Google Scholar 

  59. Lennon I, Pilkington C. The Application of AsymmetricHydrogenation for the Manufacture of Pharmaceutical­ Intermediates:The Need for Catalyst Diversity. Synthesis. 2003;11:1639-42.

  60. Fink M, Flekna G, Ludwig A, Heimbucher T, Czerny T. Improved translation efficiency of injected mRNA during early embryonic development. Dev Dyn. 2006;235:3370–8.

    Article  CAS  Google Scholar 

  61. Adams B, Dorfler P, Aguzzi A, Kozmik Z, Urbanek P, Maurer-Fogy I, et al. Pax-5 encodes the transcription factor BSAP and is expressed in B lymphocytes, the developing CNS, and adult testis. Genes Dev. 1992;6:1589–607.

    Article  CAS  Google Scholar 

  62. Pomerantz JL, Sharp PA, Pabo CO. Structure-based design of transcription factors. Science. 1995;267:93–6.

    Article  CAS  Google Scholar 

  63. O’Shea EK, Lumb KJ, Kim PS. Peptide “Velcro”: design of a heterodimeric coiled coil. Curr Biol. 1993;3:658–67.

    Article  Google Scholar 

  64. Iwamatsu T. Stages of normal development in the medaka Oryzias Latipes. Mech Dev. 2004;121:605–18.

    Article  CAS  Google Scholar 

  65. Loosli F, Koster RW, Carl M, Krone A, Wittbrodt J. Six3, a medaka homologue of the drosophila homeobox gene sine oculis is expressed in the anterior embryonic shield and the developing eye. Mech Dev. 1998;74:159–64.

    Article  CAS  Google Scholar 

  66. Koster RW, Kuhnlein RP, Wittbrodt J. Ectopic Sox3 activity elicits sensory placode formation. Mech Dev. 2000;95:175–87.

    Article  CAS  Google Scholar 

  67. Carl M, Wittbrodt J. Graded interference with FGF signalling reveals its dorsoventral asymmetry at the mid-hindbrain boundary. Development. 1999;126:5659–67.

    CAS  Google Scholar 

  68. Kitagawa D, Watanabe T, Saito K, Asaka S, Sasado T, Morinaga C, et al. Genetic dissection of the formation of the forebrain in Medaka, Oryzias Latipes. Mech Dev. 2004;121:673–85.

    Article  CAS  Google Scholar 

  69. Vancha AR, Govindaraju S, Parsa KVL, Jasti M, Gonzalez-Garcia M, Ballestero RP, et al. Use of polyethyleneimine polymer in cell culture as attachment factor and lipofection enhancer. BMC Biotechnol. 2004;4:23.

    Article  Google Scholar 

Download references

Acknowledgements

We thank Jochen Wittbrodt for the in situ probe directed against the bf1 gene and Mary Wallis for critical reading of the manuscript.

Funding

The work was supported by the Austrian Research Promotion Agency (FFG, grant 836,444), the Austrian Science Fund (FWF, grant P19571-B11) and the City of Vienna (MA23 – project 18-18). The funding sources had no role in study design, collection, analysis or interpretation of data.

Availability of data and materials

The datasets used and analysed during the current study are available from the corresponding author on reasonable request.

Author information

Authors and Affiliations

Authors

Contributions

GD, SD, NA, BB, and ER were responsible for experimental design, analysis, execution, and writing of the manuscript. MA, HB, BW and TL performed the PNA design and established and performed the chemical synthesis. TC was responsible for experimental design, analysis, writing, communication, and supervising the project. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Thomas Czerny.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

MA, HB, BW and TL were full employees of the company ugichem GmbH that developed PNAs for therapeutic applications. Design and synthesis of the PNAs was performed at the ugichem GmbH, which became insolvent 2015. All other authors declare no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Additional file

Additional file 1:

Overview of the PNA and MO induced loss of function phenotypes. Embryos at the 1-cell stage were injected with PNAs or MOs at the indicated concentrations. Phenotypes were categorized according to the size of the eyes into: weak, slightly smaller eyes; moderate, smaller eyes; strong, eye-less. Abbreviations: PNA, peptide nucleic acid; MO, morpholino oligonucleotides. (PDF 10028 kb)

Additional file 2:

Gro/Tle dependence of 1 tcf3 in gain-of-function experiments. Embryos at the 1-2 cell stage were co-injected with 40 ng/μl of the indicated gfp:HSE:Tcf3 constructs. Heat treatment (10 min, 43.5 °C) was applied at stage 14. (A) Statistical overview of the phenotype distribution. Whole mount in situ hybridization experiments for rx2 were performed on embryos at stage 21. (B) dorsal view of a stage 31 embryo with anterior at the top, (C) lateral view with anterior at the left. Arrowheads indicate ectopic otic vesicles, the arrow points to the endogenous otic vesicle. Scale bar 100 μm; B and C. (PDF 10028 kb)

Additional file 3:

Mammalian two-hybrid analysis of Aes-mediated Gro/Tle repression. 20 ng of the expression constructs (pMCamVP16, pMCTle4VP16 or pMCTle1VP16) were co-transfected with 70 ng of firefly luciferase reporter construct pLucF24ZF, 20 ng of the expression construct for the six-domain of human Six3 (pMChSix3(85-203)mZFb6) and full length Aes (pKCAes at the indicated concentrations) into HeLa cells. The interaction of the artificial leucine zipper domain “acid” and “base” [63] was used as a control. All three interactions were set 100% in the absence of Aes (acid/base corresponds to a more than 100 fold activation of the luc reporter construct compared to a control without bait, similar induction rates were seen for Tle4/Six3 and Tle1/Six3). Addition of the Aes expression construct at the indicated concentrations did not affect the acid/base interaction (blue bars), but strongly reduced the Tle4/Six3- (red bars) and the Tle1/Six3 interaction (green bars). (PDF 10028 kb)

Additional file 4:

MO-induced gro/tle loss of function phenotypes. Embryos at the 1-cell stage were co-injected with morpholino oligonucleotides and 1 μg/ml FITC-dextran. Injections were performed using either a single morpholino directed against tle1 (C), tle2b (D,F), and tle3b (E), or combinations directed against tle1 + 2b (H), tle1 + 3b (I), tle2b + 3b (J), and tle1 + 2b + 3b (K). Single morpholino oligonucleotides were injected at a concentration of 600 μM (C-F) and combinatorial injections (H-K) were performed using 300 μM of each MO. Phenotypes of FITC-dextran positive embryos were observed after the beginning of eye pigmentation at stage 32 (B-F) and stage 28 (G-K). (B,G) Wild type control embryos were injected with 1× Yamamoto’s and FITC-dextran. All embryos are shown in dorsal view with anterior at the top. Compared to the wild type controls (B,G), morpholino injected embryos developed smaller eyes that were shifted towards the midline (D,E,J,K) or cyclopic eyes (C,H,I). In rare cases the eyes were lost entirely (E). (A) Phenotypes of FITC-positive embryos were categorized at stage 28-32 into weak and strong phenotypes. Weak phenotypes developed smaller eyes that were shifted towards the midline, whereas strong phenotypes showed cyclopic eyes. Eye-less phenotypes were included into the group of strong phenotypes. Abbreviations: MO, morpholino oligonucleotide; WT, wild type. Scale bar 100 μM. (PDF 10028 kb)

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Doenz, G., Dorn, S., Aghaallaei, N. et al. The function of tcf3 in medaka embryos: efficient knockdown with pePNAs. BMC Biotechnol 18, 1 (2018). https://0-doi-org.brum.beds.ac.uk/10.1186/s12896-017-0411-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12896-017-0411-0

Keywords